Priyambodo, Priyambodo and Rustiati, Elly L. and Srihanto, Eko Agus and yulianti, yanti and Virnarenata, Elsa and Pratiwi, Dian Neli and Candra, Dedi and anggraeni, Diah E. Genetic Diversity of Captive Sumatran Elephant Based on COI Gene Sequence in Elephant Training Center, Way Kambas National Park. In: International Conference on Biological Sciences, 10-11 October 2019, Yogyakarta.

Text ICBS-2019-Abstract_Priyambodo et al_ok_Rev.01.doc Download (37kB)

Abstract

Elephant Training Center (ETC), Way Kambas National Park (WKNP) is the only ETC in Indonesia within elephant hospital inside. There are 68 captive Sumatran elephants inhabit ETC WKNP. There is high inbreeding tension due to small population size including in captivity. Information on molecular profile of each individual captive sumatran elephant in ETC WKNP is not available yet. The construction of comprehensive molecular data needs to be built for sumatran elephant conservation strategies. Study on the genetic diversity of captive sumatran elephants based on Cytochrome Subunit I gene sequence has been done in ETC WKNP under multiple year grant of Ministry of Research, Technology and Higher Education, Indonesia. The DNA of each individual was extracted from whole blood by commercial column protocol, then amplified by 5’GTGTCATTGTCACAGCACAC3’ as forward primer and 5’CTGCCAGAGGAGGATATCG3’ as reverse primer. The DNA was sequenced in Singapore by PT. Genetika Science Indonesia. Electropherogram analysis was conducted by Molecular Evolution Genetics Analysis (MEGA) 6.0. The results showed that the genetic distance between individuals within population was 0.00 with 100% homology value. Phylogenetic tree indicated closed relationship among sumatran elephants population in ETC WKNP.

Item Type:	Conference or Workshop Item (Paper)
Subjects:	Q Science > Q Science (General)
Depositing User:	Mrs Elly Lestari Rustiati
Date Deposited:	14 Nov 2019 11:02
Last Modified:	14 Nov 2019 11:02
URI:	http://repository.lppm.unila.ac.id/id/eprint/16042

Actions (login required)

View Item